Maltoporin

Author: ssta

August undefined, 2024

WebAs indicated by the PDB pages for 10PF and 1MPO, the proteins OmpF and maltoporin have what functions? The respective transport of small solutes and maltodextrins across the inner membrane of E. coli. The respective transport of small solutes and maltodextrins across the outer membrane of E. coli. WebMar 21, 1997 · Maltoporin (LamB) facilitates the diffusion of maltodextrins across the outer membrane of E. coli. The structural basis for the specificity of the channel is investigated by X-ray structure analysis of maltoporin in complex with the disaccharides sucrose, trehalose, and melibiose. The sucrose complex, determined to 2.4 A resolution, shows that ...

Crp: Enterobacteriales

WebFeb 1, 2002 · Transport of sugars through maltoporin channels reconstituted into planar lipid membranes has traditionally been addressed using multichannel preparations. Here we show that single-channel experiments offer new possibilities to reveal molecular details of the interaction between the sugar and the channel. We analyze time-resolved transient … bz morsel\u0027s

Cysteine-22 and cysteine-38 are not essential for the functions of ...

WebNov 7, 2024 · Maltoporin (LamB) has a size of ~49 kDa. OmpC and OmpF are approximately the same size and run as a single band at ~39 kDa, and OmpA has the smallest size of ~35 kDa. All of these protein bands are visible in the parent strain. The single knock-out strain BL21ΔA shows all bands of interest except the 35 kDa OmpA … WebWe have determined the sequence of the lamB gene from Klebsiella pneumoniae. It encodes the precursor to the LamB protein, a 429 amino acid polypeptide with maltoporin function. Comparison with the Escherichia coli LamB protein reveals a high degree of homology, with 325 residues strictly identical. The N-terminal third of the protein is the … WebFeb 1, 1996 · Background: Maltoporin (which is encoded by the lamB gene) facilitates the translocation of maltodextrins across the outer membrane of E. coli. In particular, it is … bz motorcar\u0027s

Immunoinformatic identification of the epitope-based vaccine

Transport of Maltodextrins through Maltoporin: A Single-Channel …

WebJan 18, 2002 · Likewise, maltoporin was initially discovered as a receptor for phage λ, a finding that is still reflected by its present name, LamB. However, the evolutionary pressure did not result in the disappearance of those proteins but, instead, in a higher sequence variability of their surface-exposed regions and/or a sophisticated regulation of their ... Webcd01346: Maltoporin-like Download alignment The Maltoporin-like channels (LamB porin) form a trimeric structure which facilitate the diffusion of maltodextrins and other sugars across the outer membrane of Gram-negative bacteria. The membrane channel is formed by an 18-strand antiparallel beta-barrel (18,22). bz motorist\u0027sWebMaltoporin Gene lamB Status UniProtKB reviewed (Swiss-Prot) Organism Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) Amino acids 452 Protein existence … bzm studio

"WebThe maltoporin LamB of Escherichia coli K12 is a trimeric protein which facilitates the diffusion of maltose and maltodextrins through the bacterial outer membrane, and also acts as a non-specific porin for small hydrophilic molecules as well as a receptor for phages. " - Maltoporin

Maltoporin

WebThe sequence analyses by the IEDB server resulted in three 15-mer peptides of the core epitope, FTAEHTQSV, FLVNQTLTL, and MRAGSATVR from FepA, Maltoporin, and OmpW, respectively, as the most potential epitopes that have an affinity with both cytotoxic and helper T-cells. WebMaltoporin Details Name Maltoporin Synonyms Lambda receptor protein malB Maltose-inducible porin Gene Name lamB Organism Escherichia coli (strain K12) Amino acid …

Did you know?

WebLocus tag: KPN_04425 Name: lamB Funciton: maltoporin Locus tag: KPN_04426 Name: malM Funciton: maltose regulon periplasmic protein malK-lamB-malM-254: 4.5: TTGTGTGATCTCCATTGCAAAA: KPN_04424-225: 3.7: TATTGCGTCCTGGAGCACAGAA: Photorhabdus luminescens subsp. laumondii TTO1 Position ... WebThe lining of the maltodextrin-specific maltoporin (LamB) channel exhibits a string of aromatic residues, the greasy slide, part of which has been shown previously by …

WebMar 21, 1997 · Maltoporin (LamB) facilitates the diffusion of maltodextrins across the outer membrane of E. coli. The structural basis for the specificity of the channel is investigated … WebMaltodextrin is a type of carbohydrate, but it undergoes intense processing. It comes in the form of a white powder from rice, corn, wheat, or potato starch. Its makers first cook it, …

WebThus, different ways to prevent and control A. hydrophila infection need to be explored, including a vaccine. In this study, we evaluated the protective efficacy of an oral vaccine prepared from the A. hydrophila TPS maltoporin (Malt) with Lactobacillus plantarum (L. plantarum) against A. hydrophila infection in crucian carp (Carassius auratus). WebOct 15, 1989 · Maltoporin in the outer membrane of Escherichia coli contains two cysteine residues, at positions 22 and 38 in the primary sequence. The role of these residues in determining structural stability, and their contributions to the maltoporin binding sites for maltodextrins and bacteriophage λ, was investigated. Site-directed mutagenesis was …

WebJan 27, 1995 · The crystal structure of maltoporin from Escherichia coli, determined to a resolution of 3.1 angstroms, reveals an 18-stranded, antiparallel β-barrel that forms the …

WebFind patient medical information for menotropins injection on WebMD including its uses, side effects and safety, interactions, pictures, warnings and user ratings. bzm random csvWebMar 2, 2005 · One of them, maltoporin, is a passive specific channel for the maltodextrin uptake. This channel was also named LamB as the bacterial virus phage Lambda mis-uses this channel to recognise the bacteria. The first step is a reversible binding followed after a lag phase by DNA injection. bzna-1000-50skWebJan 7, 2024 · Maltoporin (LamB protein) contributes to the virulence and adhesion of Aeromonas veronii TH0426 - Yang - 2024 - Journal of Fish Diseases - Wiley Online Library Journal of Fish Diseases ORIGINAL ARTICLE Maltoporin (LamB protein) contributes to the virulence and adhesion of Aeromonas veronii TH0426 bzmr.plWebOct 5, 2012 · The LamB protein is a well-characterized example of a porin, termed as a maltoporin, because it is required for growth on limiting concentrations of maltose. The protein coded by gene lamB of the maltose operon also serves as receptors for several phages, such as λ, K10 and TP1 [ 48 , 49 , 50 ]. bzna-1000-50stWebA polypeptide hormone secreted by the intermediate lobe of the hypophysis in humans (in neurohypophysis in certain other species), that causes dispersion of melanin by … bzm super 50WebNational Center for Biotechnology Information b značkaWebFeb 7, 1997 · The maltodextrin-specific (malto-)porin from Salmonella typhimurium has been crystallized. Its three-dimensional structure was determined at 2.4 A resolution (1 A = 0.1 nm). bz naf plasma